Original article: DNA-Free Genome Editing via Ribonucleoprotein (RNP) Delivery of CRISPR/Cas in Lettuce

Jongjin Park, Sunmee Choi, Slki Park, Jiyoung Yoon, Aiden Y. Park, and Sunghwa Choe. 2019. in Yiping Qi (ed.), Plant Genome Editing with CRISPR Systems: Methods and Protocols, Methods in Molecular Biology, vol. 1917,

Abstract

CRISPR/Cas9 nuclease system is getting popular in precise genome editing of both eukaryotic and prokaryotic systems due to its accuracy, programmability, and relative ease-of-use. CRISPR/Cas systems can be delivered into live cells via plasmid DNA, RNA, and ribonucleoprotein (RNP). Of these, the RNP method is of special interest due to enzymatic action in shorter time and controllability over their activity. In addition, because RNP does not involve DNA, none of unwanted DNA footprints are left in the host genome. Previously, we demonstrated that plant protoplasts can be transfected with functional RNPs and the whole plants can be regenerated from an engineered protoplast. Relative to the published methods, the revised protocols described here should help increase the success rate of whole plant regeneration by reducing damages to the naked protoplast cells.

Key words CRISPR/Cas, ribonucleoprotein (RNP), genome editing, lettuce, protoplast, tissue culture

• Introduction

The class 2 and type II in Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR) – CRISPR associated (CRISPR/Cas) system has been developed into a robust RNA-guided genome editing tool. Different from multicomponent Class 1 effector system, SpyCas9 effector protein from Streptococcus pyogenes is composed of a single polypeptide of 1,368 amino acid long and consists of three subdomains: two endonuclease domains (HNH and RuvC-like) and a DNA binding domain. The Cas effector protein in complex with dual-component guide RNAs consisting of CRISPR RNA (crRNA) and trans-acting CRISPR RNA (tracrRNA) becomes a fully functional nuclease. The two RNA components can be physically fused to form a single guide RNA (sgRNA). The CRISPR/Cas9 nuclease systems were discovered in bacteria and archaebacteria as an adaptive immune system against infecting foreign mobile genetic elements such as phages or plasmids [1, 2]. The HNH domain cleaves the DNA strand complementary to the guide RNA (gRNA) sequence, while the RuvC-like domain cuts the other non-complementary DNA strand [3, 4]. The action of ribonucleoprotein (RNP) complex of Cas9 and a sgRNA results in double-stranded breaks (DSBs) at 3 bp upstream of the 5’-NGG-3’ protospacer-adjacent motif (PAM) site in the target DNA [1, 4]. Such DSBs are repaired by non-homologous end joining (NHEJ) or homology-directed recombination (HDR) pathways. NHEJ is often error-prone such that it results in small insertion, deletions, or substitutions. These mutations may result in loss-of-function for the gene of interest.

Cas12a, formally known as Cpf1, is a class 2 type V CRISPR system found in Prevotella and Francisella [5]. Compared to Cas9, Cas12a systems possess distinct features such as single component of crRNA, recognition of 5’-TTTV-3’ PAMs and generation of staggered DNA DSBs [5, 6]. Together, CRISPR/Cas9 and Cas12a genome editing systems shed light on a various fields of biotechnology, crop breeding and medicine.

Plants have the remarkable ability to drive cellular dedifferentiation and regeneration, which are induced from various mature somatic tissues, and whole plants can be regenerated from single protoplasts through de novo organogenesis or somatic embryogenesis{Ikeuchi, 2016 #329} [7]. Development  of protoplasts into plants is cumbersome and time-consuming. However, gene editing against a single cell is the most certain way to produce edited homogeneous plants in T0 generation [8].  In addition, because RNP does not contain any deoxynucleotide, theoretically, none of unwanted DNA footprints are left in the host genome.

We and others have demonstrated RNP delivery of CRISPR/Cas9 and CRISPR/Cas12a into plant cells for genome editing [8, 9]. This DNA-free RNP delivery approach is promising for plant breeding since the resulting edited crops are likely falling outside of GMO regulation. In this chapter, we describe a detailed protocol on practicing RNP-based CRISPR genome editing using lettuce as an example. It involved four major steps: 1) purification of the Cas effector proteins and guide RNA, 2) preparation of protoplasts, 3) transfection of pre-assembled RNPs into protoplasts, and 4) regeneration of whole plants from engineered protoplasts.

• Materials
  • Plant and other materials
• 20-30 seeds of lettuce (Lactuca sativa var. Chungchima).
• MS salt with vitamins (M0222, Duchefa, RV Haarlem, Netherlands).
• Razor blades (NO.10, FEATHER SAFETY RAZOR, Osaka, Japan).
• Forceps (Cat. 3-SA, Jonostick by regine Switzerland Standard, China).
• Cell strainer (Cat. 93100, SPL, Korea).
• 1000 μl wide-bore tip (T-205-WB-C-R-S, Axygen, NY).
• Controlled environment growth chamber 24˚C (HB103M, HanBaek Scientific Co., Korea).
• pH meter (STARA2115, ThermoFisher scientific, Waltham, MA, USA).
• Sterilizer (Cat. BF-60AC, BioFree, Korea).

• PEG transfectionEnzyme solutionMannitol (M0803, Duchefa, RV Haarlem, Netherlands).KCl (P5405, Sigma-Aldrich, USA). MES (M1503, Duchefa, RV Haarlem, Netherlands).CaCl₂ (C3881, Sigma-Aldrich, Japan).BSA (A9056, Sigma-Aldrich, USA).Cellulase R-10 (Yakurt Pharmaceutical Inc., Tokyo, Japan).Macerozyme R-10 (Yakurt Pharmaceutical Inc., Tokyo, Japan).PEG solutionPEG 4000 (81240, Sigma-Aldrich, Germany).CaCl₂ (C3881, Sigma-Aldrich, Japan).Mannitol (M0803, Duchefa, RV Haarlem, Netherlands).W5 solutionNaCl (7548-4405, Daejung chemicals and metals, Korea).KCl (P5405, Sigma-Aldrich, USA). CaCl₂(C3881, Sigma-Aldrich, Japan).MES (M1503, Duchefa, RV Haarlem, Netherlands).MMG solutionMannitol (M0803, Duchefa, RV Haarlem, Netherlands).MgCl₂ (M0533, Duchefa, RV Haarlem, Netherlands).MES (M1503, Duchefa, RV Haarlem, Netherlands).Transfection reagentLipofectamine™ 3000 (L3000008, Invitrogen™, Carlsbad, CA, USA).Plus™ reagent  (11514015, Invitrogen™, Carlsbad, CA, USA)

• CRISPR/Cas9 protein purificationLB agar (204010, BD, USA).LB liquid (LB-05, LPS SOLUTION, Korea).Kanamycin (MB-K4390, MBcell, USA).BL21 Rosetta2^TM (DE3) pLysS cells (Novagen, Madison, WI) and BL21 cells (Cat. 230280, Agilent technologies, USA).pET28a-SpyCas9 plasmid (#98158, AddGene, Cambridge, Massachusetts, USA).Tris-HCl (TRI05, LPS solution, Korea).HEPES (PHG0001-100G-KC, Sigma-Aldrich, USA).PMSF (P7626, Sigma-Aldrich, Germany).Imidazol (288-32-4, Merk KGaA, Germany).IPTG (IPTG025, LPS solution, Korea).DTT (D0632, Sigma-Aldrich, Canada).Sonicator (CPX5800H-E, EMERSON, USA).Histrap-HP column (GE Healthcare Life sciences, Marlborough, MA).HiPrep desalt column (GE Healthcare Life sciences, Marlborough, MA).FPLC (AKTA^TM Avant 150, GE Healthcare bio-sciences AB, Sweden).Amicon centrifugal concentrator (VIVASPIN TURBO 15, VS15T21, Sartorius, UK).Centrifuge (COMBI-514R, Hanil science industrial, Korea).Sterilizer (Cat. BF-60AC, BioFree, Korea).Incubator for 37 °C (HB-201SL, HanBaek Scientific Co., Korea).Low temp shaking incubator (HB-201SL, HanBaek Scientific Co., Korea).

• In vitro sgRNA transcriptionA 60 mer forward oligonucleotide (Macrogen, Korea).An 80 mer reverse oligonucleotide (Macrogen, Korea).Q5 DNA polymerase (M0491, NEB, Ipswich, MA, USA).T4 DNA polymerase (M4211, Promega, Madison, WI, USA).T7 RNA polymerase (MEGAshortscript kit, AM1354, Ambion, Invitrogen, Vilnius, Lithuania).MEGAclean-up (MEGAclean-up kit, AM1908, Ambion, Invitrogen, Vilnius, Lithuania).HiScribe™ T7 High Yield RNA Synthesis Kit (NEB, Ipswich, MA).A thermocycler (SimpliAmp Thermal Cycler, ThermoFisher scientific, Waltham, MA, USA).

• In vitro cleavage assayDouble stranded DNA template.sgRNA.SpyCas9 protein (Seoul National University, Korea). Agarose (Cat.32033, iNtRON biotechnology, Korea). RedSafe (Cat.21141, iNtRON biotechnology, Korea).6X Loading dye (B7024S, NEB, Ipswich, Massachusetts, USA).Incubator at 37°C (HB-201SL, HanBaek Scientific Co., Korea).Gel electrophoresis system (MINI HD9, UVItec Cambridge, LA Abcoude, Netherlands).

• Plant regenerationB5 salt (G0209, Duchefa, RV Haarlem, Netherlands).MS salt (M0221, Duchefa, RV Haarlem, Netherlands).Sucrose (S0809, Duchefa, RV Haarlem, Netherlands).2.4-D (D0911, Duchefa, RV Haarlem, Netherlands).BAP (B0904, Duchefa, RV Haarlem, Netherlands).MES (M1503, Duchefa, RV Haarlem, Netherlands).CaCl₂  (C3881, Sigma-Aldrich, Japan).Sodium succinate (S9637, Sigma-Aldrich, China).NaFe-EDTA (E6760, Sigma-Aldrich, USA).Low melting agarose (A9045, Sigma-Aldrich, USA).Plant Agar (P1001, Duchefa, RV Haarlem, Netherlands).pH meter (STARA2115, ThermoFisher scientific, Waltham, MA, USA).Growth chamber (HB103M, HanBaek Scientific Co., Korea).Sterilizer (Cat. BF-60AC, BioFree, Korea).

1. Methods
   1. SpCas9 or FnCpf1 protein purification

Plasmid vectors, pET28a-S. pyogenes Cas9 (SpCas9) and pET28a- Francisella novicida Cpf1 (FnCpf1), are transformed into the E. coli strain BL21 DE3. The expressible fusion protein vector contains an N-terminal His 6-tag and the SpCas9 sequence spanning amino acid residues 1-1368. The procedure can be useful for the expression and purification of SpCas9, SpCas9 variants from other bacterial species, SpCas9-fused moieties proteins, FnCpf1, FnCpf1 variants from other bacterial species, and FnCpf1-fused moieties proteins.

1. Day 1—Transform pET28a-SpCas9-BPNLS or pET28a-FnCpf1-BPNLS chemically into competent BL21 RosettaTM2 (DE3) pLysS cells: Add 10 ng of plasmid DNA to 50 μl of freshly-thawed competent cells and incubate on ice for 30 min. Heat-shock cells by incubation at 42 °C for 1 min, then add 600 μl of SOC medium to the cells and incubate the culture at 37 °C for 1 h in a shaking incubator. Plate 50 μl of culture out on LB agar containing 50 μg ml/l kanamycin. Incubate the plate overnight at 37 °C.
2. Day 2—Cell Culture: Grow three 25-ml seed cultures with a serial dilution (original, 1,000×, 100,000× dilutions) in baffled flasks overnight. Pick one colony from the agar plate to inoculate 25 ml LB medium containing 50 μg ml/1 kanamycin (Original). To make 1,000X dilution, transfer 25 μl into a new 25 ml LB medium containing 50 μg ml/1 kanamycin. Then, to make 100,000X dilution, transfer 250 μl of the 1,000X diluted medium into a new 25 ml LB medium containing 50 μg ml/1 kanamycin. Incubate the preculture at 30 °C or 37 °C in a shaking incubator (250 rpm) for overnight.
3. Day 3—SpCas9 or FnCpf1 Protein Induction: Use 10 ml of the preculture to inoculate 500 ml prewarmed LB medium supplemented with 50 μg ml/l kanamycin in a 2 L baffled flask. The cells are cultured at 2 x 500 ml total volume at once. Incubate the cultures at 37 °C in a shaking incubator at 200 rpm while monitoring the cell growth every hour by measuring optical density at 600 nm (OD600). At an OD of 0.6 ~ 0.7, decrease the temperature to 18 °C and add 500 μl 0.5 M isopropyl-β-D-1-thiogalactopyranoside (IPTG) to each flask and continue shaking for 20 h.
4. Day 4—Cell Resuspension: Harvest cells by centrifugation at 4,000 rpm for 30 min in a swing-out bucket rotor in 500 ml bottles. Decant the supernatant and resuspend the cell pellets using 25 ml ice-chilled lysis buffer (20 mM Tris-HCl (pH 8.0), 0.5 M NaCl, 5 mM Imidazole, 1 mM 1,4-dithiothreitol (DTT), and 1 mM phenylmethylsulfonyl fluoride (PMSF)) per cell pellet from 1 L culture. The resuspended cell pellets can either be used directly for further purification or flash frozen in liquid nitrogen and stored at -80 °C for SpCas9 or FnCpf1 purification later.
   1. Cell Lysis: Lyse the re-suspended cell pellets using a probe sonicator. Pass the cell suspension through the homogenizer three to four times at 40 % amplitude for 1 min to ensure complete lysis. The lysate should be cooled on ice between passes.
   2. Debris Removal: Clarify the lysate by centrifugation in 50 ml Nalgene Oak Ridge tubes at 15,000 rpm (~30,000 x g) for 60 min at 4 °C. Collect the supernatant. After centrifugation, filtrate the lysate with two connected syringe filters, 1 µm and 0.45 µm, and collect the filtrate.
   3. Preparation of Binding and Elution Buffers: Prepare 1 L of the binding buffer (20 mM Tris-HCl (pH 8.0), 0.5 M NaCl, 5 mM Imidazole, and 1 mM DTT). Also, prepare 1 L of the elution buffer (20 mM Tris-HCl (pH 8.0), 0.5 M NaCl, 500 mM Imidazole, and 1mM DTT).
   4. Purification by Histrap-HP Affinity Column: All chromatographic steps are better to be performed at 4 °C. Load 20 ml the cleared lysate on the superloop at a time. Attach the column with bound protein to an FPLC system equilibrated in binding buffer (20 mM Tris-HCl (pH 8.0), 0.5 M NaCl, 5 mM Imidazole). Wash with 50 ml wash buffer at 5 ml/min until the absorbance nearly reaches the baseline again. Elute with 50 ml elution buffer (20 mM Tris-HCl (pH 8.0), 0.5 M NaCl, 500 mM Imidazole). Set the flow rate to 5 ml/min and the pressure limit to 0.3 MPa for further steps using the Histrap-HP column.
   5. Collect in two 5 ml fractions: Connect a 50 ml syringe to Histrap-HP column. Wash Histrap-HP column with 10 column volumes of distilled water. Change to a new 50 ml syringe, which connects to Histrap-HP column. Equilibrate Histrap-HP column with 10 column volumes of binding buffer. Press a syringe piston to adjust the flow rate as well as FPLC flow speed (5 ml/min). Change to a new 50 ml syringe, which connects to Histrap-HP column. Load 10 ml of the filtrate into the 50 ml syringe. Press a syringe piston to adjust the flow rate as well as FPLC flow speed (5 ml/min). Harvest flow-through to observe His-protein loss. Change to a new 50 ml syringe, which connects to Histrap-HP column. Wash the column with 10 column volumes of binding buffer. Change to a new 50 ml syringe, which connects to Histrap-HP column. Add 5 column volumes of elution buffer. Fractionate every 5 ml elute. Change to a new 50 ml syringe, which connects to Histrap-HP column. Wash the column with 10 column volumes of binding buffer.
   6. Desalting His-purified SpCas9 or FnCpf1 Protein: Desalt the 10 ml fractions with 10 ml of storage buffer (20 mM HEPES, 150 mM KCl, 1 mM DTT, pH7.5, 10 % (v/v) glycerol, 1 mM DTT) by 53 ml HiPrep desalt column. Fresh DTT should be added immediately prior to use. Analyze the peak fractions using SDS-PAGE.
   7. Estimating protein concentration by Determined by Bradford assay: Concentrate the eluted SpCas9 or FnCpf1 protein using a 30 kDa Amicon centrifugal concentrator to a concentration required for further experiments. SpCas9 or FnCpf1 protein can be concentrated up to 3 to 7 mg/ ml without precipitation. The concentration is determined based on the assumption that 1 mg/ml has an absorbance at 280 nm of 0.76 (based on a calculated extinction coefficient of 120,450/M∙cm).

• In vitro transcription of sgRNA or crRNADay 1—Dimerization of single stranded sgDNA: SpCas9 can be programmed with chimeric sgRNAs, which combine the essential parts of the crRNA and tracrRNA molecules in a single oligonucleotide chain [10]. The resulting sgRNA contains a 20-mer target specific sequence with the T7 polymerase binding site to its upstream and the Cas9 protein binding region to its downstream. Designing gene specific targeting sequences are done using a web tool CHOPCHOP (http://chopchop.cbu.uib.no). Our sgRNAs are designed to target within a coding region without any mismatches, and the sequences are preferably bearing GG at the 5’-end. The sequences are followed by NGG as their PAM motifs. When using dual-RNA guides, the crRNA guide is composed of a 5′-terminal 20-nt spacer sequence, followed by an invariant 76-nt guide RNA scaffold at the 3′ end (5’-XXXXXXXXXXXXXXXXXXXX-GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGC -3’).Preparation of transcription template for Cas9 sgRNA: The target-specific sgRNA sequences are synthesized with 17-mer T7 promoter region to their 5′-end, and 23-mer gRNA scaffold annealing region to their 3’-end, that the total length of the oligonucleotide to be 60-mer. For the transcribed sgRNA to have gRNA binding region in its 3′-end, an 80-mer gRNA scaffold sequence are also synthesized separately. Then, the 60-mer and 80-mer oligonucleotides are annealed together using a thermocycler, and a complete dsDNA were synthesized using T4 DNA polymerases and the annealed dimerized oligonucleotides as the template. An alternative gRNA synthesis method is introduced (see Note 1). Preparation of transcription template for FnCpf1 crRNA: A plasmid carrying T7 promoter and guide RNA scaffold is constructed. Only a target 20 bp double stranded oligonucleotide is cloned into the end of guide RNA scaffold by two BsaI type IIS restriction enzyme from golden gate cloning method (see Fig. 1b). A forward single oligonucleotide should embody 5′-AGAT-3′ overhang in front of the target 20 nt, while a reverse single oligonucleotide gets initiated with 5′-AAAA-3′ in front of the reverse target 20 nt. Both one picomole of forward and reverse single oligonucleotides are mixed in 45 µl distilled water, which is transferred into 0.2 ml PCR tube, and anneal at 95 °C for 5 min and 55 °C for 10 min by a thermocycler, then place annealed double stranded oligonucleotides (dsODN) on ice. As a result, the dimerized oligonucleotides are employed to clone into a linear plasmid with two flanking sequences, 5′-ATCT-3′ and 5′-TTTT-3′. The completed construct is used to synthesize sgRNAs as templates. An alternative gRNA synthesis method is introduced (see Note 2). Day 2—Amplification of dsDNA templates for sgRNAs by PCR amplification: Transcription templates for sgRNA synthesis can be PCR amplified from plasmid or synthetic oligonucleotide templates with appropriate PCR primers (A forward primer is 5′-AATTCTAATACGACTCACTATAGG-3′, which has additional five AATTC nt in front of T7 promoter sequence and a reverse primer is from end of sgRNA scaffold 5′-GCACCGACTCGGTGCCACTT-3′). The high amount of dsDNA template is obtained simply by PCR performance. Q5® polymerase is used to amplify transcription templates. PCR products should be subjected to DNA electrophoresis to estimate concentration and to confirm amplicon size prior to its use as a template in the T7 RNA transcription synthesis. PCR mixture may be used directly if diluted at least 10X in the transcription reaction. However, better yields will be obtained with purified PCR products. PCR products can be purified according to the protocol for commercial clean-up kit instruction. Details of PCR are shown as follows.

PCR program

95 °C	3 min	x1
95 °C	15 sec
60 °C	30 sec	x 35
72 °C	30 sec
72 °C	10 min	x 1
17 °C	Hold

PCR components

Component	Amount	Volume
Template	plasmid DNA or oligodimers (30 ng/μl)	1    μl
Forward Primer	5 Mm	1    μl
Reverse Primer	5 Mm	1    μl
dNTP	2.5 Mm dNTP	1    μl
Reaction buffer	5x Q5® polymerase buffer	5    μl
Polymerase	Q5® polymerase	0.5   μl
Water	14.5   μl
Final volume	25   μl

• sgRNA transcription by T7 RNA polymerase: Generally, 1.4 µM (1 µg of a 120 bp PCR product or annealed dsODN) can be used in a 20 µl in vitro transcription reaction. Employing 1 µg templates is critically required to harvest 100 µg sgRNAs with above 1 µg/µl high concentration (see Note 3). Thaw MEGAshortscript T7 Transcription Kit or HiScribe™ T7 High Yield RNA Synthesis Kit components, mix and pulse-spin in microfuge to collect solutions to the bottoms of tubes. Keep on ice. Assemble the reaction at room temperature as follows.

Transcription components

Name                                     Component                                   Volume

Template         PCR products or oligodimers (100 ng/μl)            8    μl

dATP                T7 ATP solution (75 mM)                                     2    μl

dCTP                T7 CTP solution (75 mM)                                     2    μl

dTTP                T7 TTP solution (75 mM)                                     2    μl

dGTP                T7 GTP solution (75 mM)                                     2    μl

Polymerase           T7 enzyme Mix                                                 2    μl

Polymerase buffer      10X T7 reaction buffer                               2    μl

Final reaction volume                                                                     20   μl

Mix thoroughly and pulse-spin in a microfuge. Incubate at 37 °C for 4 hours or longer (O/N available) for maximum yield. It is safe to incubate the reaction for 16 hours. Amount of sgRNA may be synthesized sufficiently in 4 hours. It is recommended to incubate in a thermocycler to prevent evaporation of the sample. DNase is applied to remove DNA template. To remove template DNA, add 20 μl nuclease-free water to each 20 μl reaction, followed by 2 μl of DNase I (RNase-free), mix and incubate for 15 minutes at 37 °C.

• Day3—Clean-up sgRNA:  After 15 min, transcripts are cleaned-up through MEGAclean-up kit. The products are transferred into a new 1.5 ml tube. Added 100 μl with Elution Solution. Mix and add 350 μl of Binding Solution Concentrate to the sample. Mix by pipetting, add 250 μl of 100% ethanol to the sample and mix by pipetting. Follow the manual of MEGAclean-up kit, the mixed samples are transferred into spin-down column/2 ml tube. Centrifuge at 12,000 rpm for one min. The flow-through is discarded. Add 500 μl of washing solution. Centrifuge at 12,000 rpm for one min. Discard the flow-through. Repeat one more time, add 500 μl of washing solution. Centrifuge at 12,000 rpm for one min. Discard the flow-through. The spin-column/2 ml tubes are centrifuged at 12,000 rpm for one min. The spin-column only is transferred into a new 1.5 ml tube. Add 50 μl of water into the spin-column/1.5 ml tube each. Put the spin-column/1.5 ml tubes on the heat-block at 70 ℃ for 10 min. After 10 min, the spin-column/1.5 ml tubes are centrifuged at 12,000 rpm for one min. Add additionally 50 μl of water into the spin-column/1.5 mL tube each. The flow-through is measured the concentration of sgRNA.
  • <Alternative> Clean-up crRNA for FnCpf1: After 15 min, transcript products are also cleaned-up through ethanol precipitation. The ethanol precipitation is recommended to precipitate sgRNAs with smaller size RNA than 100 nt. FnCpf1 crRNA size is 66 nt being much smaller than 100 nt, which is a preparation limit when using MEGAclean-up kit. Add 1/10 volume 3M sodium acetate of PCR products to PCR products, and invert for mixing gently. Add ice-chilled 100% ethanol to each sample tube. Incubate the sample tubes in -20 ℃ for 30 min. Centrifuge the precipitated sgRNAs at 14,000 rpm (16,900 x g) for 10 min at 4 ℃. Remove supernatant and wash the RNA pellet with 200 μl ice-chilled 70% ethanol. Centrifuge for one min, remove supernatant and air-dry RNA pellets for 5 min. Dissolve the RNA pellet in 50 μl RNase-free water. RNA concentration can be determined by measuring the ultraviolet light absorbance at 260 nm.

• Plant transformation and regeneration

3.2.1 Prepare plants and reagents for protoplast transformation

1. Sterilize lettuce seeds by 2 % Sodium hypochlorite (Clorox) for 10 min.
   1. Wash seeds 5 times with sterile dH₂O.
   1. Plant the sterile seeds on ½ MS media. Lettuce leaves can be harvested 5 days after germination for protoplast preparation.
   1. Make 40 ml enzyme solution with ingredients as follows:

0.4 M Mannitol

20 mM KCl

20 mM MES (pH 5.7)

1.5 % Cellulase R-10 (Yakurt)

% Macerozyme R-10 (Yakurt)

• Incubate at 55 °C for 10 min.
• Add to make 10 mM CaCl₂ and 0.1 % BSA.
  • Filter enzyme solution through a 0.45 μm syringe filter.

• Protoplast preparationCut ten to fifteen leaves from lettuce plantlets with a razor. Pile two or three leaves on a droplet of sterile water. Slice piled leaves together. Pour a 20 ml enzyme solution into a 90 mm diameter plate. Transfer sliced fifteen leaves in a 20 ml enzyme solution. Cover it with Aluminum foil.
• Place the 90 mm plate at gyratory shaker with 50 rev/min. Incubate the plate for four to five hours.
• Pour the enzyme solution with protoplasts in a round tube. Add the same volume of W5 solution to the 20 ml enzyme solution (W5 ingredients shown as follows).

W5 solution

154 mM NaCl

125 mM CaCl2

5 mM KCl

2 mM MES (pH 5.7)

• Flow the 40 ml enzyme solution containing protoplasts through a 100 μm cell strainer into a 50 ml round tube.
• Remove the cell strainer.
• Centrifuge the 50 ml tube at 100 g (or 80 g in Hanil centrifuge, Korea) for 5 min.
• Remove the supernatant using a 20 ml long pipette.
•  Add a 1 ml of MMG solution (ingredients shown below).

MMG solution	5 ml	10 ml
0.8 M Mannitol	2.5 ml	5 ml
300 mM MgCl2	0.25 ml	0.5 ml
200 mM MES (pH 5.7)	0.1 ml	0.2 ml

1.  Count protoplasts with a hematocytometer.
2. Adjust cell number up to 2 x 10⁶/ml by adding MMG solution.
3. Aliquot 200 μl containing 2 x 10⁵/ml protoplasts into a 1.5 ml tube (see Fig. 2a and 2b).

• Transformation of protoplasts with CRISPR RNPsSet up a 20 μl transformation reaction in 1.5 ml tube as follows.

RNP	2 x 105/ml protoplasts
sgRNA	5 μg
Cas9 protein	10 μg
Plus reagent™	2 μl
Lipofectamine™ 3000	2 μl
NEB Buffer 3.1	2 μl
dH2O up to	20 μl

Both Lipofectamine™ 3000 and Plus reagent™ transfection reagents are utilized for RNP delivery with PEG 4000. RNP combination can be replaced by Cpf1/other Cas proteins. GFP-Cas9 is employed to help to trace Cas9 localization instead of Cas9 in this study. (see Fig. 2c and 2d).

• Incubate RNP transformation mixture for 10 min at room temperature.
  • Aliquot 200 μl protoplast solution with a 1,000 μl wide bore tip into a clean 1.5 ml tube.
  • Add the RNP mixture into the 200 μl protoplast solution, then mix gently.
  • Add the same volume (220 μl) of 40% PEG solution (shown below) into RNP-protoplast solution.

40% PEG solution	5 ml	10 ml
0.8 M Mannitol	1.25 ml	2.5 ml
1M CaCl2	0.5 ml	1 ml
PEG 4000	2 g	4 g
dH2O up to	5 ml	10 ml

• Pipette the RNP-protoplast-PEG solution five to ten times gently.
  • Place the RNP-protoplast-PEG solution for 10 min at room temperature.
  • Add an 800 μl W5 solution into the RNP-protoplast-PEG solution, then invert four to five times.
  • Centrifuge at 100 g for 1 min in a large table top centrifuge, then discard the supernatant.
  • Add 400 μl W5 solution and sequentially, add 400 μl Plant Induction Medium (PIM) without sucrose into a protoplast pellet.
  • Centrifuge at 100 g for 1 min in a large table top centrifuge, then discard the supernatant.
  • Add a 500 μl Protoplast Induction Media (PIM) (shown below) into a protoplast pellet and re-suspend the pellet.

PIM	1L
1/2 B5 medium	1.58 g
Sucrose	103 g
2,4-D	0.2 mg
BAP	0.3 mg
MES	0.1 g
CaCl2∙2H2O	375 mg
NaFe-EDTA	18.35 mg
Sodium succinate	270 mg

• Mix protoplasts with 2.4% low-melting gel in PIMTransfer protoplasts in 500 μl PIM (with sucrose) into a 6 well plate (3.5 cm diameter) with a 1,000 μl wide bore tip.Add a 500 μl PIM (with sucrose) containing 2.4 % low melting gel.Plate the mixture, PIM and low melting gel, by Bergmann’s cell plating technique.  Change PIM solution every week.After four weeks, transfer low-melting agar with micro-calli to Shoot Induction Media (SIM) (see Fig 3d).

SIM	1 L
MS powder	4.4 g
Sucrose	30 g
0.1 mg NAA	100ul (1mg/ml stock)
0.5 mg BAP	500ul (0.1mg/ml stock)
Plant agar	6 g

• After four weeks, transfer calli from SIM to MS media (see Fig 3e).
  • Transfer tiny plantlets into MS media (see Fig 3f).

• NotesAn alternative method for preparing transcription template for SpCas9 sgRNA: A plasmid carrying T7 promoter and guide RNA scaffold is constructed. Only a target 20 bp double stranded oligonucleotide is cloned into the middle of two BsaI sites (A↓TAGGTGAGACCGCAGGTCTCG↓GTTTT) placed between T7 promoter and guide RNA scaffold by two BsaI type IIS restriction enzyme from Golden Gate cloning method (see Fig.  1a). A forward single oligonucleotide should embody 5′-TAGG-3′ overhang in front of the target 20 nt, while a reverse single oligonucleotide gets initiated with 5′-CAAA-3′ in front of the reverse target 20 nt. Both one picomole of forward and reverse single oligonucleotides are mixed in 45 µl distilled water, which is transferred into 0.2 ml PCR tube, and anneal at 95 °C for 5 min and 55 °C for 10 min by a thermocycler, then place annealed oligonucleotides on ice. As a result, the dimerized oligonucleotides are employed to clone into a linear plasmid with two flanking sequences, 5′-CCTA-3′ and 5′-GTTT-3′. The completed construct is used to synthesize sgRNAs as templates.An alternative method to prepare a transcription template for FnCpf1 crRNA: Synthesize two 63 nt single stranded oligonucleotides, which compose of 5 nt overhang in front of T7 promoter, 19 nt T7 promoter, and 20 nt target spacer sequence. Both 10 µl of 200 nmol of forward and reverse single oligonucleotides are mixed, and the 20 µl mixture is transferred into a 0.2 ml PCR tube, and annealed at 95 °C for 5 min and 55 °C for 10 min by a thermocycler, then place annealed dsODN on ice.It is strongly recommended to wear gloves and use nuclease-free tubes and reagents to avoid RNase contamination. Reactions are typically 20 μl but can be scaled up as needed. Reactions should be assembled in nuclease-free micro centrifuge tubes or PCR strip tubes.

Reference

1.         Jinek M, Chylinski K, Fonfara I, Hauer M, Doudna JA, Charpentier E: A programmable dual-RNA-guided DNA endonuclease in adaptive bacterial immunity. Science 2012, 337(6096):816-821.

2.         Mali P, Aach J, Stranges PB, Esvelt KM, Moosburner M, Kosuri S, Yang L, Church GM: CAS9 transcriptional activators for target specificity screening and paired nickases for cooperative genome engineering. Nat Biotechnol 2013, 31(9):833-838.

3.         Nishimasu H, Ran FA, Hsu PD, Konermann S, Shehata SI, Dohmae N, Ishitani R, Zhang F, Nureki O: Crystal structure of Cas9 in complex with guide RNA and target DNA. Cell 2014, 156(5):935-949.

4.         Ma E, Harrington LB, O’Connell MR, Zhou K, Doudna JA: Single-Stranded DNA Cleavage by Divergent CRISPR-Cas9 Enzymes. Mol Cell 2015, 60(3):398-407.

5.         Zetsche B, Gootenberg JS, Abudayyeh OO, Slaymaker IM, Makarova KS, Essletzbichler P, Volz SE, Joung J, van der Oost J, Regev A et al: Cpf1 is a single RNA-guided endonuclease of a class 2 CRISPR-Cas system. Cell 2015, 163(3):759-771.

6.         Fagerlund RD, Staals RH, Fineran PC: The Cpf1 CRISPR-Cas protein expands genome-editing tools. Genome Biol 2015, 16:251.

7.         Ikeuchi M, Ogawa Y, Iwase A, Sugimoto K: Plant regeneration: cellular origins and molecular mechanisms. Development 2016, 143(9):1442-1451.

8.         Woo JW, Kim J, Kwon SI, Corvalan C, Cho SW, Kim H, Kim SG, Kim ST, Choe S, Kim JS: DNA-free genome editing in plants with preassembled CRISPR-Cas9 ribonucleoproteins. Nat Biotechnol 2015, 33(11):1162-1164.

9.         Kim H, Kim ST, Ryu J, Kang BC, Kim JS, Kim SG: CRISPR/Cpf1-mediated DNA-free plant genome editing. Nat Commun 2017, 8:14406.

10.       Anders C, Jinek M: In vitro enzymology of Cas9. Methods Enzymol 2014, 546:1-20.